I have reviewed this Bemisia genome paper with interest: this is a long time that the community is expecting the release of the genome of this Hemipteran pest, and I am satisfied to see that a consortium tackled the difficulty.
This is a regular genome paper whose aim I guess is to provide basic data of an annotated genome and a few analyses. There is thus an interest to publish it, if the community has access to a well-structured genome database of B. tabacci, so that the community will still improve annotation and provide new knowledge with other analyses. My first recommendation is thus to provide this access, more than from NBCI. I suggest the authors to contact the i5k community who developed a dedicated database for insects, with a nice interface allowing search, blast and web Apollo annotation (I am not member of this i5k database!).
As I said before, the general analyses are global, and centered on specific gene families such as detoxification (in relation to insecticide resistance and host plant interactions) and immune system (in relation to endosymbiont relationship). There are thus many other gene families that would deserve analyses but I understand that this might not be essential for the paper. But as the paper focuses on a small number of family genes, I would expect more biological experiments that would allow testing some of the hypotheses suggested by the authors. For instance, authors could provide some RNA expression data of candidate genes (e.g. P450) on different host plants or insecticides, or from different Bemisia populations with others insecticide resistance profiles. Or some experiments on the IMD pathways such as the one provided for the A. pisum paper. I don't say the authors should provide all these analyses, but at least put more biological data.
The hypothesis of HGT is also interesting, but it is known that final demonstration is complicated. So please revise a bit the text to lower the fact that this is an HGT. It could be, but this remains to be demonstrated.
Another trait of Bemisia is the transmission of plant viruses, as the authors several times mention it in the text. I would expect some gene family analysis of proteins that possibly play roles in virus transport (vesicle processes?).
The text needs strong English editing. Some parts are OK, but others are different to follow. I suggest the English-native co-authors carefully check all the manuscript, including figure and table legends.
Other minor points:
Does the strain that have been sequenced disseminate plant viruses?
Males are haploid. For Hymenoptera genome projects, males are usually used for sequencing in order to get rid off heterozygocity. I am not a specialist of whitefly biology, but why did not you use only male individuals for this genome project?
The authors used CEGMA for quality control of sequencing and assembly. I would suggest using BUSCO which proposed a larger set of conserved proteins for Insects or Arthropods. The authors will thus have a better assessment of their genome I guess.
The authors could check within the non-assembled reads whether some missing genes that are not present in the assembly might be there, or even other bacterial sequences/genomes.
Repetitive element analysis is a bit poor. No possibility to describe a bit more the different families of transposons?
The gene coverage section is short and difficult to follow (page 11 lines 10 and following).
In the text, comparison of insect-symbionts system is very difficult to follow too.
Conclusion (at least as it is today) is not necessary: too long and redundant with the text.
Figure 3: any possibility to put all the proteins present in the table within the figure/flow chart?
Figure 4: I guess that the arrows showing the transfer of metabolites are not demonstrated but suggested by this work? Please mention it.
Figure 5: please improve the legends that are not clear and incomplete (e.g. what are the green boxes in 5B?).
Figure S4, Table S3, Table S7, Table S9; not sure they are necessary.

Are the methods appropriate to the aims of the study, are they well described, and are necessary controls included?
If not, please specify what is required in your comments to the authors.
Yes

Are the conclusions adequately supported by the data shown?
If not, please explain in your comments to the authors.
Yes

Does the manuscript adhere to the journal’s guidelines on minimum standards of reporting?
If not, please specify what is required in your comments to the authors.
Yes

Are you able to assess all statistics in the manuscript, including the appropriateness of statistical tests used?
(If an additional statistical review is recommended, please specify what aspects require further assessment in your comments to the editors.)
No, I do not feel adequately qualified to assess the statistics.

Quality of written English
Please indicate the quality of language in the manuscript:
Not suitable for publication unless extensively edited.

Declaration of competing interests
Please complete a declaration of competing interests, considering the following questions:
Have you in the past five years received reimbursements, fees, funding, or salary from an organisation that may in any way gain or lose financially from the publication of this manuscript, either now or in the future?
Do you hold any stocks or shares in an organisation that may in any way gain or lose financially from the publication of this manuscript, either now or in the future?
Do you hold or are you currently applying for any patents relating to the content of the manuscript?
Have you received reimbursements, fees, funding, or salary from an organization that holds or has applied for patents relating to the content of the manuscript?
Do you have any other financial competing interests?
Do you have any non-financial competing interests in relation to this paper?
If you can answer no to all of the above, write 'I declare that I have no competing interests' below. If your reply is yes to any, please give details below.
I declare that I have no competing interests.

I agree to the open peer review policy of the journal. I understand that my name will be included on my report to the authors and, if the manuscript is accepted for publication, my named report including any attachments I upload will be posted on the website along with the authors' responses. I agree for my report to be made available under an Open Access Creative Commons CC-BY license (http://creativecommons.org/licenses/by/4.0/). I understand that any comments which I do not wish to be included in my named report can be included as confidential comments to the editors, which will not be published.
I agree to the open peer review policy of the journal.

Authors' response to reviews:

Reviewer: 1
The article needs to be greatly improved but very important data. After reading the article I'm left asking myself- why did the team sequence the genome?

The title is using incorrect nomenclature for this species complex. All references to biotype are obsolete. Please see the literature below and revise.

Key literature surrounding the nomenclature of the species complex are missing. References 9 and 10 are outdated. I recommend a complete literature search of the topic but read
1. Wang, H.L., J. Yang, L. M. Boykin, Q.Y. Zhao, Y.J. Wang, S.S. Liu, X.W. Wang. 2014. Development, characterization and analysis of microsatellite markers from the transcriptomes of three whitefly Bemisia tabaci species. Scientific Reports. doi:10.1038/srep06351.
2. Tay, W.T., G. A. Evans, L.M. Boykin, P.J. De Barro. 2012. Will the real Bemisia tabaci please stand up? PLoS ONE 7(11): e50550. doi:10.1371/journal.pone.0050550.
3. Boykin, L.M., K.F. Armstrong, L. Kubatko, and P. De Barro. 2012. Species Delimitation and Global Biosecurity. Evolutionary Bioinformatics 8: 1-37.
4. Boykin, L.M. 2014. Bemisia tabaci nomenclature: Lessons learned. Pest Management Science 70:1454-59.
Avoid the "sibling" species terminology. Remove all reference to biotype throughout the manuscript. What is "strain selection"? Later in the paper MED/Q is used. Be consistent with the naming.
RESPONSE: We echo Dr. Laura Boykin’s sentiments about the nomenclature of the Bemisia tabaci species complex. According to her suggestion, we eliminated “biotype” throughout the manuscript and replaced “sibling” with “cryptic” species. “Strain selection” has been removed to avoid confusion.

As for the references, we included all four publications recommended by the reviewer. The debate over Bemisia tabaci as a complex species or species complex has been over a half century. To acknowledge this part of the history, and also to show “MED/Q was inadvertently introduced into several geographic locations worldwide, and became established throughout China”, we would like to not exclude the references referring B. tabaci as biotypes. References 9 and 10 (listed here) represent some of the major discoveries from our research group, and were published recently in well-respected peer-reviewed journals. The nomenclature in these publications is debatable; however, the contents are relevant and up-to-date.
9. Pan HP, Preisser EL, Chu D, Wang SL, Wu QJ, Carriere Y, et al. Insecticides promote viral outbreaks by altering herbivore competition. Ecol Appl. 2015; 25:1585-1595. PMID: 26552266.
10. Liu BM, Yan FM, Chu D, Pan HP, Jiao XG, Xie W, et al. Multiple forms of vector manipulation by a plant-infecting virus: Bemisia tabaci and tomato yellow leaf curl virus. J Virol. 2013; 87:4929-37. doi:10.1128/JVI.03571-12.

The introduction does not properly review the literature or set up the read for the study that has been conducted or why it is important to have a genome for this particular B. tabaci species.

The discussion need to be rewritten completely. There are no scientific questions that were set out to be answered with this genome paper. I recommend reading: http://bfg.oxfordjournals.org/content/early/2016/06/22/bfgp.elw026.long and paying attention to the reference: http://www.sciencedirect.com/science/article/pii/S1471492214000762

The days of "sequence-first-ask-questions-later" are over and this paper needs to be greatly improved with well defined research questions relevant to Bemisia tabaci species before it can be published anywhere.
RESPONSE: Based on reviewer’s suggestion, we carried out additional experiments to address specific biological questions. We totally agree that genome sequencing should have clear biological purposes. With the additional RNAi-based functional data, we elected “insecticide resistance” as the focal point to reorganize and rewrite the discussion in the revised manuscript.

Reviewer: 2
I have reviewed this Bemisia genome paper with interest: this is a long time that the community is expecting the release of the genome of this Hemipteran pest, and I am satisfied to see that a consortium tackled the difficulty. This is a regular genome paper whose aim I guess is to provide basic data of an annotated genome and a few analyses. There is thus an interest to publish it, if the community has access to a well-structured genome database of B. tabacci, so that the community will still improve annotation and provide new knowledge with other analyses. My first recommendation is thus to provide this access, more than from NBCI. I suggest the authors to contact the i5k community who developed a dedicated database for insects, with a nice interface allowing search, blast and web Apollo annotation (I am not member of this i5k database!).
RESPONSE: To share the genome information using i5K database platform is a great idea, we will certainly contact i5K community after the conclusion of this publication. In the meantime, we have already uploaded the genome sequence onto NCBI and GigaDB. NCBI maintains genome sequences of plants, animals and microbes, and can be readily accessed through user-friendly interfaces, including blast, Map Viewer, and CD Tree. GigaDB contains 268 discoverable, tractable and citable databases that are available for public download and use. Therefore, we are comfortable using these two databases to share B. tabacci genomic resources.

As I said before, the general analyses are global, and centered on specific gene families such as detoxification (in relation to insecticide resistance and host plant interactions) and immune system (in relation to endosymbiont relationship). There are thus many other gene families that would deserve analyses but I understand that this might not be essential for the paper. But as the paper focuses on a small number of family genes, I would expect more biological experiments that would allow testing some of the hypotheses suggested by the authors. For instance, authors could provide some RNA expression data of candidate genes (e.g. P450) on
different host plants or insecticides, or from different Bemisia populations with others insecticide resistance profiles. Or some experiments on the IMD pathways such as the one provided for the A. pisum paper. I don't say the authors should provide all these analyses, but at least put more biological data.
RESPONSE: Based on Dr Denis Tagu’s suggestion, we selected one of the main interests from our group, insecticide resistance, as the focal point for the discussion section. A total of 12 genes encoding detoxification enzymes, including 9 P450s and 3 GSTs, were subjected to RNAi-based functional validation studies to investigate their potential involvement in the imidacloprid resistance.

The hypothesis of HGT is also interesting, but it is known that final demonstration is complicated. So to lower the fact that this is an HGT. It could be, but this remains to be demonstrated. please revise a bit the text
RESPONSE: Based on reviewer’s suggestion, we toned down the HGT hypothesis.

Another trait of Bemisia is the transmission of plant viruses, as the authors several times mention it in the text. I would expect some gene family analysis of proteins that possibly play roles in virus transport (vesicle processes?).
RESPONSE: Most recently, a group at the Cornell University published Bemisia B genome (Chen et al., 2016) with a focus on the genomic signatures contributing to virus transmission. We cited this work in the revised manuscript.

Chen et al. 2016. The draft genome of whitefly Bemisia tabaci MEAM1, a global crop pest, provides novel insights into virus transmission, host adaptation, and insecticide resistance. BMC Biology.

The text needs strong English editing. Some parts are OK, but others are different to follow. I suggest the English-native co-authors carefully check all the manuscript, including figure and table legends.
RESPONSE: Revisions have been made according to reviewer’s suggestion.

Other minor points:
Does the strain that have been sequenced disseminate plant viruses?
RESPONSE: Yes, B. tabaci Q is notorious for its ability to transmit plant viruses.

Males are haploid. For Hymenoptera genome projects, males are usually used for sequencing in order to get rid off heterozygocity. I am not a specialist of whitefly biology, but why did not you use only male individuals for this genome project?
RESPONSE: We are aware of the strategies to minimizing the heterozygocity. However, for B. tabaci, it is difficult to distinguish the adult sex with the naked eyes, its size is too small to generate enough genetic materials individually for the genome sequencing. We, therefore, used unsexed, mass collection of B. tabaci adults for the sequencing.

The authors used CEGMA for quality control of sequencing and assembly. I would suggest using BUSCO which proposed a larger set of conserved proteins for Insects or Arthropods. The authors will thus have a better assessment of their genome I guess.
RESPONSE: Based on reviewer’s suggestion, we used BUSCO to evaluate the quality of B. tabaci genome, gene set, and transcriptome. There are 2,675 conserved arthropod proteins in total. As shown in the following table, we have detected 79% complete and fragmented BUSCOs in B. tabaci genome, 88% in gene set, and 70% in transcriptome.

Pattern Genome Gene set Transcriptome
Number % Number % Number %
Complete BUSCOs 1399 52% 2105 78% 1276 47%
Complete and single-copy BUSCOs 1118 42% 1434 54% 985 10%
Complete and duplicated BUSCOs 281 10% 671 25% 291 11%
Fragmented BUSCOs 706 26% 257 9.6% 595 22%
All (Complete and Fragmented) 2105 79% 2362 88% 1871 70%
Missing BUSCOs 570 21% 313 11% 804 30%

Based on this assessment, we would like to stay with the CEGMA analysis in this manuscript.

The authors could check within the non-assembled reads whether some missing genes that are not present in the assembly might be there, or even other bacterial sequences/genomes.
RESPONSE: 1) We mapped all WGS clean data covering different insert libs from 170bp to 40kb into B. tabaci MED/Q-type genome by SOAPaligner/soap2 V2.21t. Then non-assembled reads were filtered to assemble through software SOAPdenovo, and a draft sequence with 385Mb genome size was constructed. 2) In order to check whether any sequence existed in previous B. tabaci MED/Q-type genome, the 385Mb assembled sequence was again aligned to B. tabaci MED/Q-type genome with software blast and filtered 65Mb unmapped-assembled sequences (333,000 sequences). 3) Functional analysis was utilized to analyze the composition of these unmapped sequences through mapping them to NT database by software blast. On one hand, we mapped these unmapped-assembled sequences into the transcript sequences to search EST sequences by software blat. Secondly, a homolog based alignment with Acyrthosiphon pisum was ran by software Blast and Genewise. And then, we merged the gene set though Glean and got nine genes. Finally, we aligned these nine genes into B. tabaci MED/Q-type coding genes and into B. tabaci MED/Q-type genome by blast. Results shown four genes were successfully mapped into the B. tabaci MED/Q coding genes, and five not. That is, we got five unmapped genes, which might be missing gene in the present assemble. Functional analysis was again to search their function in NR database from NCBI by blast, and all these five genes were all annotated as gene indeed belong to B. tabaci (Tables 1 and 3). One the other hand, we found these unmapped-assembled sequences mainly include bacteria sequences from the following species (Table 2).

Table 1. Function analysis with NR database of missing genes
Gene ID Description Max score
Total score
Query cover
E value
Identity
Accession
Gene1 PREDICTED: rho GTPase-activating protein 190 isoform X1 [Bemisia tabaci]
179 179 0.81 2E-50 0.97 XP_018903139.1

Gene2 PREDICTED: DNA polymerase epsilon catalytic subunit A [Bemisia tabaci]
272 272 0.94 5E-82 0.98 XP_018915083.1

Gene5 PREDICTED: lysosomal alpha-glucosidase-like [Bemisia tabaci]
259 259 0.99 2E-83 0.99 XP_018911552.1

Gene6 PREDICTED: acetylcholinesterase [Bemisia tabaci]
209 209 1 2E-61 1 XP_018906011.1

Gene7 PREDICTED: MIF4G domain-containing protein isoform X2 [Bemisia tabaci]
106 106 1 3E-26 1 XP_018899706.1


Table 2. The organisms of unmapped-assemble sequences
Organism Mapped sequence number
Candidatus Hamiltonella 931
Pseudomonas fluorescens 928
Pseudomonas sp. 767
Pseudomonas trivialis 609
Flavobacterium johnsoniae 553
Methylotenera mobilis 236
Cardinium endosymbiont 183
Pseudomonas poae 69
Sphingobacterium sp. 60
Pseudomonas brassicacearum 42
Pseudomonas chlororaphis 34
Pseudomonas fragi 33
Pseudomonas mandelii 25
Pseudomonas putida 25
Chryseobacterium sp. 21

Table 3. Missing sequences
>Gene7 locus=C60404577:235:387:-
ATGGACCAGATGCGCATTCAATTTTTAAAGCAAACCACTTCGCCTAGTTTTCGGAAAACTTTGCTGCAAATGATCGAACTAAGAGCAAGCAAGTGGGCTCTTCCAGTTGAAAGTATTATTTACTACTATCCTAGCAATAGCCAAAAAAAGTAA
>Gene5 locus=C60410339:723:1079:+
ATGACATCAACTAATTGGGCGCTTGCTGATGAATGTGCCATTGTTCCAAATGAAGACAGATTTGACTGTTTCCCACGCGGACCTTCCAACGAATCGGTTTGTACTCAACGAGGCTGTTGCTGGAAACCCACTGAGAGCCGCACTGAAATGGATGGATTTAAGAAACTGGATGTCCCTTGGTGTTACTACCCAGTTGCTTTTAAGTCGTACGAGCAGGTGAATAAAACAGTAGCCAATCATGTCACCACTGTCTTTCTGAGAAATGTTATTAAGTCACCCTATCCTGATGATGTGCCTCTTCTCAGAATGGTCATCAAAGCGGAATCCAACTTCAGGGTTCATGTTAAGGTGAGTTAA
>Gene1 locus=C60412988:80:1241:+
ATGAATAATATAGATGTATTTTTCTACGTGCAATTTTTTCAATTTCTCTCCTTGCTTTTTCAGTCTGACTTCAGCGGAAGAGTCGTTAATAACGACCATTTCCTGTATTGGGGTGAAGTATCCAAAGCAACAGAGGAAGGAGCGGAAATTCAGTTTCAAGTCATCGAGCAAACTGAATTCATCGATGACGCATCCTTTCAGCCATTTAAAGGTGGCAAAATGGAGCCTTATATTAAACGATGTGCGGCAGTCAAGTTGACATCAGCAGAGAAACTCATGTACATTTGTAAAAATCAATTAGGTAAGTTCAGATTGTTGTAA
>Gene2 locus=C60415092:393:1815:-
GCTAAAAAACAGGTTGCAGAAGCTCTTGAAAAAAATGATGCTGGAGAGATAAAATCTGCGAAAAATCGTGAAGTTTTGTATGACTCTTTACAAATAGCTCACAAATGCATCCTGAACTCTTTTTATGGTTACGTCATGCGGAAAGGCGCCAGATGGCATAGTATGGAGATGGCTGGAATAGTGTGTCACACTGGAGCTAATATCATCACAAGAGCTAGAGAAATCATTGAAAAAGTTGGTCGACCACTTGAATTAGATACAGATGGTATTTGGTGTGTTTTACCTGCATCTTTTCCAGAAAATTATGTGATTAATTCCACACATCCGGGCAAAAGTAAAATTACCATCTCTTACCCAAATGCTGTACTGAATTCCATGGTGAAGGTAATTTTTGTTGTGGTACATATATGTTCTTGCTAA
>Gene6 locus=C60415266:261:957:+
ATGTTGTCAGACTTTCTCTTCAGAGCTCCTGTTGATCACATCGTAAAACTCCTCGTCAGTCAAGACGTTCCTACATATATGTACGTCATGAATACAACGGTCGAAGCTTTGCGCCTGCCTGAATGGAGGAAATACCCTCACAACATCGAACATTACTTCCTCACTGGAGCACCCTTCATGGACACAGAATTTTTCCCTCCAAGCGCCCATCTTGAAAGGAATATGTGGACGGACAATGATAGGAACATGAGTCACTTTTTCATGAAAGCTTATTCAAACTTTGCAAAATATGGGTAA

Repetitive element analysis is a bit poor. No possibility to describe a bit more the different families of transposons?
RESPONSE: Revisions have been made according to reviewer’s suggestion.

The gene coverage section is short and difficult to follow (page 11 lines 10 and following).
RESPONSE: Revisions have been made according to reviewer’s suggestion (Table S15).

In the text, comparison of insect-symbionts system is very difficult to follow too.
RESPONSE: Revisions have been made according to reviewer’s suggestion (Figure 4).

Conclusion (at least as it is today) is not necessary: too long and redundant with the text.
RESPONSE: Revisions have been made according to reviewer’s suggestion.

Figure 3: any possibility to put all the proteins present in the table within the figure/flow chart?
RESPONSE: Revisions have been made according to reviewer’s suggestion (Figure 3).

Figure 4: I guess that the arrows showing the transfer of metabolites are not demonstrated but suggested by this work? Please mention it.
RESPONSE: Please see revised figure legend.

Figure 5: please improve the legends that are not clear and incomplete (e.g. what are the green boxes in 5B?).
RESPONSE: Revisions have been made according to reviewer’s suggestion.

Figure S4, Table S3, Table S7, Table S9; not sure they are necessary
RESPONSE: Figure S4, Table S3, Table S7 and Table S9 supported the statements in the manuscript. We, therefore, would like to keep these figure and tables in the supplementary materials.

Dear authors and editors,
With the recent publication of a Bemisia tabacci genome paper (BMC Biology, 2016 14:110) by a concurrent group, we have now two Bemisia genomes, released by two different consortia. More complicated, some authors are signing both papers! This situation is not well appropriate for the community. To which reference genome will the community refer to? It is really a pity that the two consortia did not work together to share means and ideas instead of duplicating sequencing and analyses.
I am thus forced to consider the submitted paper as a Data Note, since it does not afford strong novelty compare to the other genome. That's the stupid and unfortunate result of competition, instead of collaboration.
And at least, the two consortia should now communicate in order to define a reference genome, and to help the community to find their way. I do consider i5k as a central point for proposing access to insect genomes and I clearly invite the authors to contact them once/if the paper is accepted.

Concerning the re-submission, I thank the authors for having evaluating my suggestions. The addition of RNAi on some genes potentially involved in insecticide resistance is a clear added-value.
CEGMA versus BUSCO: I still think BUSCO is better than SEGMA but it is not a critical issue. The authors can stand with CEGMA, even if I suggest giving both analyses (CEGMA and BUSCO) to help the readers to estimate the chance to get a full sequence of genes.


So my rejection concerns a publication in GigaScience as a Research Report, but is an acceptation for a Data Note.

Sorry for being so severe, but I feel really bad in front of these situations.


All the best
Denis

Are the methods appropriate to the aims of the study, are they well described, and are necessary controls included?
If not, please specify what is required in your comments to the authors.
Yes

Are the conclusions adequately supported by the data shown?
If not, please explain in your comments to the authors.
Yes

Does the manuscript adhere to the journal’s guidelines on minimum standards of reporting?
If not, please specify what is required in your comments to the authors.
Yes

Are you able to assess all statistics in the manuscript, including the appropriateness of statistical tests used?
(If an additional statistical review is recommended, please specify what aspects require further assessment in your comments to the editors.)
Yes, and I have assessed the statistics in my report.

Quality of written English
Please indicate the quality of language in the manuscript:
Acceptable.

Declaration of competing interests
Please complete a declaration of competing interests, considering the following questions:
Have you in the past five years received reimbursements, fees, funding, or salary from an organisation that may in any way gain or lose financially from the publication of this manuscript, either now or in the future?
Do you hold any stocks or shares in an organisation that may in any way gain or lose financially from the publication of this manuscript, either now or in the future?
Do you hold or are you currently applying for any patents relating to the content of the manuscript?
Have you received reimbursements, fees, funding, or salary from an organization that holds or has applied for patents relating to the content of the manuscript?
Do you have any other financial competing interests?
Do you have any non-financial competing interests in relation to this paper?
If you can answer no to all of the above, write 'I declare that I have no competing interests' below. If your reply is yes to any, please give details below.
I declare that I have no competing interests.

I agree to the open peer review policy of the journal. I understand that my name will be included on my report to the authors and, if the manuscript is accepted for publication, my named report including any attachments I upload will be posted on the website along with the authors' responses. I agree for my report to be made available under an Open Access Creative Commons CC-BY license (http://creativecommons.org/licenses/by/4.0/). I understand that any comments which I do not wish to be included in my named report can be included as confidential comments to the editors, which will not be published.
I agree to the open peer review policy of the journal.

Authors' response to reviews:

Reviewer: 2
Dear authors and editors,
With the recent publication of a Bemisia tabacci genome paper (BMC Biology, 2016 14:110) by a concurrent group, we have now two Bemisia genomes, released by two different consortia. More complicated, some authors are signing both papers! This situation is not well appropriate for the community. To which reference genome will the community refer to? It is really a pity that the two consortia did not work together to share means and ideas instead of duplicating sequencing and analyses.
I am thus forced to consider the submitted paper as a Data Note, since it does not afford strong novelty compare to the other genome. That's the stupid and unfortunate result of competition, instead of collaboration.
And at least, the two consortia should now communicate in order to define a reference genome, and to help the community to find their way. I do consider i5k as a central point for proposing access to insect genomes and I clearly invite the authors to contact them once/if the paper is accepted.

RESPONSE: We certainly respect reviewer’s opinions regarding the two independent Bemisia genome-sequencing efforts. The following are additional information for reviewer and editor to consider:
1. MED/Q and MEAM1/B are the two most invasive cryptic species within the Bemisia tabaci species complex. Although they share similar ecology niche, B and Q have distinctively different biological traits, including host range, virus transmission, endosymbiont composition and insecticide resistance (De Barro et al. 2011; Liu et al. 2012; Pan et al. 2015). Therefore, having these two genomes can greatly benefit the whitefly research community instead of confusing it. Some specific biological distinctions are as follows:
MEAM1/B and MED/Q vary in their mating behavior and prefer different host plants (Crowder et al. 2010, 2011, Elbaz et al. 2011, Tsueda and Tsuchida 2011).
Although both can vectoring viruses, the feeding behavior of MED/Q renders it more competent vector than MEAM1/B for acquiring and transmitting TYLCV and other viruses (Jiang et al. 2000; Pan et al. 2012).
Differential susceptibility to insecticides drives the B. tabaci colony displacement in China (Pan et al., 2015). MEAM1/B invaded China in the early 1990s, it rapidly replaced indigenous B. tabaci and became the most dominant species throughout China (Luo et al., 2002). MED/Q was first found in Yunnan Province, China, in 2003 (Chu et al., 2006), and has now displaced the well-established MEAM1/B populations in most parts of China (Chu et al., 2010; Teng et al., 2010; Pan et al., 2011; Pan et al., 2015). The key to this drastic displacement event has been attributed to the higher tolerance of MED/Q than MEAM1/B to nearly all commonly used insecticides (Horowitz et al., 2005; Dennehy et al., 2010; Xie et al., 2014; Pan et al., 2015).
Finally, MED/Q originated from the Mediterranean region, and it was widely distributed in many Mediterranean countries, Asia, Canada and America. Phylogenetic analyses of mitochondrial cytochrome oxidase I (mtCOI) sequences suggest that the MED group can be divided into three subclades, known as Q1, Q2 and Q3 (Tsagkarakou et al. 2007; Ahmed et al. 2009; McKenzie et al. 2012). In China, Q1 is the only haplotype identified so far, and the most dominant B. tabaci species (Zheng et al. 2016). In contrast, all three distinct mitochondrial haplotypes of B. tabaci Q (Q1, Q2 and Q3) were detected in North America (McKenzie et al. 2012).

2. We are fully aware of the sequencing efforts of Bemisia tabaci B genome. We are excited to see the final publication of the B genome, and have cited this work in our previous revision (Ref 32. Chen W, Hasegawa DK, Kaur N, Kliot A, Pinheiro PV, Luan JB, et al. The draft genome of whitefly Bemisia tabaci MEAM1, a global crop pest, provides novel insights into virus transmission, host adaptation, and insecticide resistance. In Press. 2016. BMC Biology).
Drs. Youjun Zhang and Zhangjun Fei, the principle investigators for Bemisia
tabaci Q and B genome sequencing consortia, respectively, have been communicating throughout the sequencing and submission processes. As a result, we have shared some of the expertise from our co-authors. Dr. Fei paid a visit to Dr. Zhang’s research group in 2015, and they agreed to coordinate the submission process. Therefore, the initial submission date of B. tabaci Q and B genome manuscripts were almost the same. During the review and revision processes, however, the two manuscripts go the separate ways. For example, we spent almost three months to carry out additional experiments to empirically examine the hypothesis derived from the B. tabaci Q genome. In contrast, BMC Biology did not ask for the biological validation for the B. tabaci B genome, which translates into an earlier publication. Nevertheless, there is clearly no animosities between the two genome consortia. Within the Bemisia tabaci community, we share each other’s expertise. In fact, Dr. Wenbo Chen, the first author of the B. tabaci B genome paper, had previously worked in Dr. Youjun Zhang’s research group as a visiting scientist for six month.

Concerning the re-submission, I thank the authors for having evaluated my suggestions. The addition of RNAi on some genes potentially involved in insecticide resistance is a clear added-value.
RESPONSE: We appreciated reviewer giving us the opportunity to improve this work, and we believe the revised version is a clearly better manuscript.

CEGMA versus BUSCO: I still think BUSCO is better than CEGMA but it is not a critical issue. The authors can stand with CEGMA, even if I suggest giving both analyses (CEGMA and BUSCO) to help the readers to estimate the chance to get a full sequence of genes.
RESPONSE: Following reviewer’s suggestion, we now incorporated both analyses in the revised manuscript.

So my rejection concerns a publication in GigaScience as a Research Report, but is an acception for a Data Note. Sorry for being so severe, but I feel really bad in front of these situations.
RESPONSE: We hope the new information regarding the biological distinctions between B and Q, in conjunction with the fact that the two Bemisia genome consortia have been communicated throughout the sequencing and submission processes and shared the expertise between the two groups can let reviewer to reconsider his decision.

Reference
1. De Barro PJ, Liu SS, Boykin LM, Dinsdale AB. Bemisia tabaci: a statement of species status. Ann Rev Entomol. 2011; 56:1-19.
2. Liu SS, Colvin J, De Barro PJ. Species concepts as applied to the whitefly Bemisia tabaci systematics: how many species are there? J Integr Agric. 2012; 11:176-186.
3. Crowder DW, Sitvarin MI, Carrie` re Y. Plasticity in mating behaviour drives asymmetric reproductive interference in whiteflies. Anim Behav. 2010b; 79:579–587.
4. Elbaz M, Weiser M, Morin S. Asymmetry in thermal tolerance trade-offs between the B and Q sibling species of Bemisia tabaci (Hemiptera: Aleyrodidae). J Evolution Biol. 2011; 24:1099–1109.
5. Tsueda H, Tsuchida K. Reproductive differences between Q and B whiteflies, Bemisia tabaci, on three host plants and negative interactions in mixed cohorts. Entomol Exp Appl. 2011; 141:197–207.
6. Jiang YC, de Blas C, Barrios L, Fereres A. Correlation between whitefly (Homoptera: Aleyrodidae) feeding behavior and transmission of tomato yellow leaf curl virus. Ann Entomol Soc Am. 2000; 93:573–579.
7. Pan HP, Chu D, Yan WQ, Su Q, Liu BM, Wang SL. et al. Rapid spread of tomato yellow leaf curl virus in China is aided differentially by two invasive whiteflies. PLoS ONE. 2012; 7:e34817.
8. Luo C, Yao Y, Wang RJ, Yan FM, Hu DX, Zhang ZL. The use of mitochondrial cytochrome oxidase I (mtCO I) gene sequences for the identification of biotype of Bemisia tabaci (Gennadius) in China. Acta Entomol Sin. 2002; 45:759-763.
9. Chu D, Zhang YJ, Brown JK, Cong B, Xu BY, Wu QJ. et al. The introduction of the exotic Q biotype of Bemisia tabaci from the Mediterranean region into China on ornamental crops. Fla Entomol. 2006; 89:168-174.
10. Chu D, Wan FH, Zhang YJ, Brown JK. Change in the biotype composition of Bemisia tabaci in shandong province of China from 2005 to 2008. Environ Entomol. 2010; 39:1028-1036.
11. Teng X, Wan FH, Chu D. Bemisia tabaci biotype Q dominates other biotypes across China. Fla Entomol. 2010; 93:363-368.
12. Pan HP, Chu D, Ge D, Wang SL, Wu QJ, Xie W. et al. Further Spread of and domination by Bemisia tabaci (Hemiptera: Aleyrodidae) biotype Q on field crops in China. J Econ Entomol. 2011; 104:978-985.
13. Pan HP, Preisser EL, Chu D, Wang SL, Wu QJ, Carriere Y. et al. Insecticides promote viral outbreaks by altering herbivore competition. Ecol Appl. 2015; 25:1585-1595.
14. Horowitz AR, Kontsedalov S, Khasdan V, Ishaaya I. Biotypes band Q of Bemisia tabaci and their relevance to neonicotinoid and pyriproxyfen resistance. Arch Insect Biochem. 2005; 58:216-225.
15. Dennehy TJ, Degain BA, Harpold VS, Zaborac M, Morin S, Fabrick JA. et al. Extraordinary resistance to insecticides reveals exotic Q biotype of Bemisia tabaci in the New World. J Econ Entomol. 2010; 103:2174-2186.
16. Xie W, Liu Y, Wang SL, Wu QJ, Pan HP, Yang X. et al. Sensitivity of Bemisia tabaci (Hemiptera: Aleyrodidae) to several new insecticides in China: effects of insecticide type and whitefly species, strain, and stage. J Insect Sci. 2014; 14:261.
17. Tsagkarakou A, Tsigenopoulous CS, Gorman K, Lagnel J, Bedford ID. Biotype status and genetic polymorphism of the whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) in Greece: mitochondrial DNA and microsatellites. Bull Entomol Res. 2007; 97:29-40.
18. Ahmed MZ, Shatters RG, Ren SX, Jin GH, Mandour NS, Qiu BL. Genetic distinctions among the Mediterranean and Chinese populations of Bemisia tabaci Q biotype and their endosymbiont Wolbachia populations. J Appl Entomol. 2009; 133:733-741.
19. Zheng HX, Xie W, Wang SL, Wu QJ, Zhou XM, Zhang YJ. Dynamic monitoring (B versus Q) and further resistance status of Q-type Bemisia tabaci in China. Crop Prot. 2016. Doi: 10.1016/j.cropro.2016.11.035.
20. McKenzie CL, Bethke JA, Byrne FJ, et al. Distribution of Bemisia tabaci (Hemiptera: Aleyrodidae) biotypes in North America after the Q invasion. J Econ Entom. 2012; 105: 753-766.

Dear authors,

I am OK with the very last version of your paper now as a note.

I still apologize that the genome is badly available. We can of course download the data, but biologists will need a database to browse, search for annotated genes and so on and so forth. And again, i5K@NAL provides very easily this service. It's up to you to follow or not this advice, but integratinfg in i5k database will give more visibility to your genome.

Table 1 indicates differences in the two genomes that are mainly due, to my opinion, to the different approaches used for sequencing, assembling and annotating the genomes.

Now that those two strains have been sequenced, this opens new tracks for further studies on population genomics and phylogeograpghy, which is great.

All the best